View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_178 (Length: 251)
Name: NF0214_low_178
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_low_178 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 7298804 - 7299048
Alignment:
Q |
1 |
tgaaatcaccctaaataagtcaaaattttgtgtatgaaatcacttttatctctatctaccttaaaaccaaa-tacacacctagacatagagaggacacag |
99 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
7298804 |
tgaaatcaccctaaataagtcaaaattttgtgtatgaaatcccttttatctctatctaccttaaaaccaaaatacacacctagacatagagaggacacag |
7298903 |
T |
 |
Q |
100 |
aaatcaagttgcaagttggcatgaaagcatgcctgtgactgtgtaatgtatcccatatccttatccttctttggcgctgctgtctgtatatggcagaatc |
199 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7298904 |
aaatcaagttgcaagttggcatgaaagcatgcctgtgactgtgtaatgtatcccatatccttatccttctttggcgctgctgtctgtatatggcagaatc |
7299003 |
T |
 |
Q |
200 |
cttctctttctcagctacatatcagactcagacagacctatgata |
244 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7299004 |
cttctctttctcagctacatatcagactcagacagacctatgata |
7299048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1354 times since January 2019
Visitors: 2391