View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_180 (Length: 250)
Name: NF0214_low_180
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_low_180 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 23970441 - 23970216
Alignment:
| Q |
1 |
atgggtaaaacatgtgtttcttttttacatggttatgtttcaactttgcatatattatagagtcaatttgatcagttaacgctttctaaaaataaagaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
23970441 |
atgggtaaaacatgtgtttcttttttacatggttatgtttcaactttgcatatattatagagtcaatttgaacggttaacgctttctaaaaataaagaac |
23970342 |
T |
 |
| Q |
101 |
t--tatagctatttaaatcgtagaaaacataacgtttactatcattcctatatcccaaaaaagaa---aatgatttcctagcacgatttcaaatttactt |
195 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23970341 |
ttatatagctatttaaatcgtagaaaacataacgtttactatcattcctatatcccaaaaaagaaattaatgatttcctagcacgatttcaaatttactt |
23970242 |
T |
 |
| Q |
196 |
ttattatcttgaaaggatgatgcata |
221 |
Q |
| |
|
|||||||||||||| | ||||||||| |
|
|
| T |
23970241 |
ttattatcttgaaaagttgatgcata |
23970216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University