View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_188 (Length: 244)
Name: NF0214_low_188
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_low_188 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 188
Target Start/End: Original strand, 17365371 - 17365558
Alignment:
| Q |
1 |
tgtattttgattaacagttacgttgatctaccatttgacaaaaactataatttaagcttcaacaaaatctttgtataagccctttnnnnnnntcatagta |
100 |
Q |
| |
|
||||||||||||||||||| | |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
17365371 |
tgtattttgattaacagttgcattgatctaccgtttgacaaaaactataatttaagcttcaacaaaatctttgtataagccctttaaaataatcatagta |
17365470 |
T |
|
| Q |
101 |
taagtataatgttactgcaacttgttcaaatttatcgtgatttcaaacatgcaatacgaattttgatcatttaatagtatattattaa |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17365471 |
taagtataatgttactgcaacttgttcaaatttattgtgatttcaaacatgcaatacgaattttgatcatttaatagtatattattaa |
17365558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1335 times since January 2019
Visitors: 2391