View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_193 (Length: 225)
Name: NF0214_low_193
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_low_193 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 137
Target Start/End: Original strand, 46837387 - 46837524
Alignment:
Q |
1 |
ttatcattatttgctttatcattgactctcaaactagagatttt-attcgattaataattagattgagaaagttaacttttatcaagactcttagttatc |
99 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46837387 |
ttatcattatttgctttatcattgactctcaaactagagatttttattcgattaataattagattgagaaagttaacttttatcaagactcttagttatc |
46837486 |
T |
 |
Q |
100 |
actccgctcttattgcaggtgattgatgagtatgatga |
137 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||| |
|
|
T |
46837487 |
actcccctcttattgcaggtgattgatgagtatgatga |
46837524 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University