View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_194 (Length: 223)
Name: NF0214_low_194
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_low_194 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 120
Target Start/End: Original strand, 27469979 - 27470098
Alignment:
| Q |
1 |
tttcgaggagggaaaggccaatgttgataagggtcgatattagagattaataggaaatgtgatttatttggcatacactaggcctgatgtggcatacgca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |
|
|
| T |
27469979 |
tttcgaggagggaaaggccaatgttgataagggtcgatattagagattaataggaaatgtgatttatttggcacacactaggcctgatgtggcatatgca |
27470078 |
T |
|
| Q |
101 |
tagagtgtggtgaaccaatt |
120 |
Q |
| |
|
||||||||||||| |||||| |
|
|
| T |
27470079 |
tagagtgtggtgagccaatt |
27470098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1502 times since January 2019
Visitors: 2391