View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_195 (Length: 223)
Name: NF0214_low_195
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_low_195 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 120
Target Start/End: Original strand, 27469979 - 27470098
Alignment:
| Q |
1 |
tttcgaggagggaaaggccaatgttgataagggtcgatattagagattaataggaaatgtgatttatttggcatacactaggcctgatgtggcatatgca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27469979 |
tttcgaggagggaaaggccaatgttgataagggtcgatattagagattaataggaaatgtgatttatttggcacacactaggcctgatgtggcatatgca |
27470078 |
T |
 |
| Q |
101 |
tagagtgtggtgaaccaatt |
120 |
Q |
| |
|
||||||||||||| |||||| |
|
|
| T |
27470079 |
tagagtgtggtgagccaatt |
27470098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 60 - 113
Target Start/End: Original strand, 39779423 - 39779476
Alignment:
| Q |
60 |
tgatttatttggcatacactaggcctgatgtggcatatgcatagagtgtggtga |
113 |
Q |
| |
|
|||||||||||||| |||||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
39779423 |
tgatttatttggcacacactaggccagatttggcatatgcaataagtgtggtga |
39779476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University