View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_201 (Length: 212)
Name: NF0214_low_201
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_low_201 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 22 - 183
Target Start/End: Original strand, 40763710 - 40763871
Alignment:
| Q |
22 |
catacatttttcaacaagcatgggtttctttatgtgcgcacgccaattgtcacgacaagtgattgtgagggtgctggtgaaatgtttcaagtgacaactc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40763710 |
catacatttttcaacaagcatgggtttctttatgtgcgcacgccaattgtcacgacaagtgattgtgagggtgctggtgaaatgtttcaagtgacaactc |
40763809 |
T |
|
| Q |
122 |
tgttcagtgaagcagagaggttggagaaggaactgatacagaatcctcctcctactgaatct |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40763810 |
tgttcagtgaagcagagaggttggagaaggaactgatacagaatcctcctcctactgaatct |
40763871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 130 - 183
Target Start/End: Original strand, 40763938 - 40763991
Alignment:
| Q |
130 |
gaagcagagaggttggagaaggaactgatacagaatcctcctcctactgaatct |
183 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40763938 |
gaagcagaaaggttggagaaggaacagatacagaatcctcctcctactgaatct |
40763991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 22 - 180
Target Start/End: Original strand, 42911438 - 42911596
Alignment:
| Q |
22 |
catacatttttcaacaagcatgggtttctttatgtgcgcacgccaattgtcacgacaagtgattgtgagggtgctggtgaaatgtttcaagtgacaactc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42911438 |
catacatttttcaacaagcatgggtttctttatgtgcacacgccaattgtcacgactagtgattgtgagggtgctggtgaaatgtttcaagtgacaactt |
42911537 |
T |
|
| Q |
122 |
tgttcagtgaagcagagaggttggagaaggaactgatacagaatcctcctcctactgaa |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42911538 |
tgttcagtgaagcagagaggttggagaaggaactgatacagaatcctcctccaactgaa |
42911596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1454 times since January 2019
Visitors: 2391