View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_202 (Length: 209)
Name: NF0214_low_202
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_low_202 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 79 - 209
Target Start/End: Complemental strand, 21956067 - 21955937
Alignment:
Q |
79 |
gtttgggtgttatgggagaagggaggtttgtggtggtgttgggcatggtggaagatttgaagggagagataagggtcgtgttggcgggaaatgagagatg |
178 |
Q |
|
|
||||||| |||||| ||||| ||||||||||| |||| |||||| ||| |||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
T |
21956067 |
gtttgggggttatgagagaatggaggtttgtgatggttttgggcgtggaggaagatttgaagggagaaatgagggtcgtgttggcgggaaatgagagatg |
21955968 |
T |
 |
Q |
179 |
agaggaggttggggttgaggcggtggggcca |
209 |
Q |
|
|
||||||| ||||||||||||||||||||||| |
|
|
T |
21955967 |
agaggagtttggggttgaggcggtggggcca |
21955937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University