View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_23 (Length: 488)
Name: NF0214_low_23
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 402; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 402; E-Value: 0
Query Start/End: Original strand, 29 - 458
Target Start/End: Original strand, 42117151 - 42117579
Alignment:
| Q |
29 |
aggttgatcaggccgtaaccccccgaaccaaagcgatcaagatttatgccccgataggttgggctcataacttccaatagggatattttcatgatttcta |
128 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42117151 |
aggttgatcgggccgtaacccc-cgaaccaaagcgatcaagatttatgccccgataggttgggctcataactcccaatagggatattttcatgatttcta |
42117249 |
T |
|
| Q |
129 |
aaggcatgtgagcaattgaagagacctattgagaaatcttaatacacaaggggtaaaattatgtcatgtaatgttgggctcatagatagctaataggtac |
228 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42117250 |
aaggcatgtgagcaattgaagggacctattgagaaatcttaatacacaaggggtaaagttatgtcatgtaatgttgggctcatagatagctaataggtac |
42117349 |
T |
|
| Q |
229 |
aagttatgggttgctctgctatcacaatttatccacttattcttcttcccttcatcctgtttatctcaacctctcatcttcaaaggtgaaccaacaaagc |
328 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42117350 |
aagtaatgggttgctctgctatcacaatttatccacttattcttcttcccttcatcctgtttatctcaacctctcatcttcaaaggtgaaccaacaaagc |
42117449 |
T |
|
| Q |
329 |
tgcaaactctttaaaccaagccatatatgattaggtcgatctcctctacatcaattatagtcttcaatgctttagaccttgtctcttcttcactatataa |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42117450 |
tgcaaactctttaaaccaagccatatatgattaggtcgatctcctctacatcaattatagtcttcaatgctttagaccttgtctcttcttcactatataa |
42117549 |
T |
|
| Q |
429 |
gcctcttttacataacatgaacaaaacaaa |
458 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42117550 |
gcctcttttacataacatgaacaaaacaaa |
42117579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1240 times since January 2019
Visitors: 2389