View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_62 (Length: 388)
Name: NF0214_low_62
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_low_62 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 30 - 326
Target Start/End: Original strand, 37974355 - 37974648
Alignment:
Q |
30 |
gtgtacttaaggaccatcgctcaccactcataaccaagcatagtttctaagttctgacactatgacaataacaaagaccaagacaagaggttcctataca |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37974355 |
gtgtacttaaggaccatcgctcaccactcataaccaagcatagtttctaagttctgacactatgacaataacaaagaccaagacaagaggttcctataca |
37974454 |
T |
 |
Q |
130 |
tctttatgacttcaattactgcgtgtgatccagattcactttagtactatattcatcatgttgttccaattatggtttttaaatattgattcccacttcg |
229 |
Q |
|
|
||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
37974455 |
tctttatgagttcaattactgcgtgtgatccagattcactttaatactatattcatcatgttgttccaattatggtttttaaatattgattcccactttg |
37974554 |
T |
 |
Q |
230 |
ctcatgggtgtatgtttggattcacgttttaagaagtgtctgtttgattaagcgtctcaagttggcatatgtagcttctgcctaaaggtgatttttt |
326 |
Q |
|
|
|| ||||||| ||||||||||| ||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
37974555 |
cttatgggtgaatgtttggattgacgtttt---aagtgtctgtttgattaagcgtcccaagttggcatatgtagcttctgcctaaaggtcatttttt |
37974648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1804 times since January 2019
Visitors: 2393