View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_64 (Length: 387)
Name: NF0214_low_64
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_low_64 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 295; Significance: 1e-165; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 295; E-Value: 1e-165
Query Start/End: Original strand, 29 - 378
Target Start/End: Original strand, 32528002 - 32528349
Alignment:
Q |
29 |
aaccataactaagaatcacggaagtgaaaaggtcttgatacataaaatgaccgataaccaatcgcatatccaaaatgagggatcgacaaatctgagcacc |
128 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
32528002 |
aaccataactaagaatcacggaagcgaaaaggtcttgatacataaaatgaccgataaccaatcacatatccaaaatgagggatcgacaaatctgagcacc |
32528101 |
T |
 |
Q |
129 |
ataaatagtaaaacgacaacacatgaaagaacaccatcaaatattaacagacacaaaaccaccattgtggttggcaataaaccaaacgccttgaaagttg |
228 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32528102 |
ataaatagtaaaacgacgacacatgaaagaacaccatcaaatattaacagacacaaaaccaccattgtggttggcaataaaccaaacgccttgaaagttg |
32528201 |
T |
 |
Q |
229 |
tagatttggaaagaaccagaaatcagaggcaagaaatacaaccacaaactaaagatttcaaactgaacctacctagatggggnnnnnnnnnnccaaaacc |
328 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
32528202 |
tagatctggaaagaaccagaaatcagaggcaagaaatacagccacaaactaaagatttcaaactgaacctacctagatgggg--tttttcttccaaaacc |
32528299 |
T |
 |
Q |
329 |
actgacgtaaccgccagagttctgaaataacaatggacaaacattcatct |
378 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32528300 |
actgacgtaaccgccagagttctgaaataacaatggacaaacattcatct |
32528349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1988 times since January 2019
Visitors: 2396