View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_70 (Length: 360)
Name: NF0214_low_70
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_low_70 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 32 - 331
Target Start/End: Complemental strand, 7299236 - 7298937
Alignment:
| Q |
32 |
tagagactacaaccaaatgagcaaaatctgtgtattcttttgagtctccaaaaggaattattattgcttaggaaaaatgatgcttttgctagttggttta |
131 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7299236 |
tagagactgcaaccaaatgagcaaaatctgtgtattcttttgagtctccaaaaggaattattattgcttaggaaaaatgatgcttttgctagttggttta |
7299137 |
T |
 |
| Q |
132 |
ttatggtatgaaaagttgggaccattttggtttaaagtcattttctatgtagccaatttacttggctttgaagaaagtgcataacttctatcataggtct |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7299136 |
ttatggtatgaaaagttgggaccattttggtttaaagtcattttctatgtagccaatttacttggctttgaagaaagtgcataacttctatcataggtct |
7299037 |
T |
 |
| Q |
232 |
gtctgagtctgatatgtagctgagaaagagaaggattctgccatatacagacagcagcgccaaagaaggataaggatatgggatacattacacagtcaca |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7299036 |
gtctgagtctgatatgtagctgagaaagagaaggattctgccatatacagacagcagcgccaaagaaggataaggatatgggatacattacacagtcaca |
7298937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University