View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_71 (Length: 359)
Name: NF0214_low_71
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_low_71 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 11 - 293
Target Start/End: Original strand, 22836798 - 22837080
Alignment:
| Q |
11 |
cacagacctatgcacatggtacggtgtctcttgtcttaggaaccgtgtctcccgcctagtcctcgaaaacctcgacctccacggctcgatggaaccgtta |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22836798 |
cacaaacctatgcacatggtacggtgtctcttgtctaagaaaccgtgtctcccgccttgtcctcgaaaacctcgacctccacggctcgatggaaccgtta |
22836897 |
T |
|
| Q |
111 |
accgcacttactcagctccgtgtactcagccttaaacgcaaccgtttcaacggtcccattccaaatctctccaacttaacttcactaagacttctgttcc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
22836898 |
accgcacttactcagctccgtgtactcagccttaaacgcaaccgtttcaacggtcccattccaaatctctccaacttaacttcactaagacttttgttcc |
22836997 |
T |
|
| Q |
211 |
tttcttacaataatttctccggtgagtttccggaaagtttaaccttgttaacccgtctctaccggcttgatctcgctgataac |
293 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22836998 |
tttcttacaacaatttctccggtgagtttcccgaaagtttaacctcgttaacccgtctctaccggcttgatctcgctgataac |
22837080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1445 times since January 2019
Visitors: 2391