View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0214_low_73 (Length: 355)

Name: NF0214_low_73
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0214_low_73
NF0214_low_73
[»] chr1 (1 HSPs)
chr1 (80-259)||(28525553-28525732)


Alignment Details
Target: chr1 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 80 - 259
Target Start/End: Complemental strand, 28525732 - 28525553
Alignment:
80 cacagacatctttcttcactaaagattggaatgtgagatctattgccgctaaatcctcaacataatttataggccatttcactaagcatcccatatgaat 179  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
28525732 cacagacatctttcttcactaaagattggaatgtgagatctattgccgctaaatcctcaacataatttataggccatttcactaagcataccatatgaat 28525633  T
180 ttgatatgatggccatatcctagttcaaaaaaccctacataaatctttatcccaattaaaggaggatctttggtaccaat 259  Q
    |||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28525632 ttgatatgatggccatattctagttgaaaaaaccctacataaatctttatcccaattaaaggaggatctttggtaccaat 28525553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1019 times since January 2019
Visitors: 2388