View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_73 (Length: 355)
Name: NF0214_low_73
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_low_73 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 80 - 259
Target Start/End: Complemental strand, 28525732 - 28525553
Alignment:
Q |
80 |
cacagacatctttcttcactaaagattggaatgtgagatctattgccgctaaatcctcaacataatttataggccatttcactaagcatcccatatgaat |
179 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
28525732 |
cacagacatctttcttcactaaagattggaatgtgagatctattgccgctaaatcctcaacataatttataggccatttcactaagcataccatatgaat |
28525633 |
T |
 |
Q |
180 |
ttgatatgatggccatatcctagttcaaaaaaccctacataaatctttatcccaattaaaggaggatctttggtaccaat |
259 |
Q |
|
|
|||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28525632 |
ttgatatgatggccatattctagttgaaaaaaccctacataaatctttatcccaattaaaggaggatctttggtaccaat |
28525553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University