View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_78 (Length: 353)
Name: NF0214_low_78
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_low_78 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 34932844 - 34933097
Alignment:
| Q |
1 |
atgtgcgcaggagttatttcgtgtgcgtatctcgatgggcatcccgctgagtatctcatctttgcgctatagatgttgaagatttgggagagagtcggct |
100 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34932844 |
atgtgcgcaggagttattccgtgtgtgtatctcgatgggcatcccgctgagtatctcatctttgcactatagatgttgaagatttgggagagagtcggct |
34932943 |
T |
|
| Q |
101 |
tcgcagataatatgaaagaacagaattgttagatggtaattagatgatgatgatgatatgtactaattaattaaacacactctatcaaaactaatataat |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34932944 |
tcgcagataatatgaaagaacaaaattgttagatggtaattagatgatgatgatgatatgtactaattaattaaacacactctatcaaaactaatataat |
34933043 |
T |
|
| Q |
201 |
cattccatcaaagaagagaaaatcccgaattcataaggtttaaaccctaacccc |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34933044 |
cattccatcaaagaagagaaaatcccgaattcacaaggtttaaaccctaacccc |
34933097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1101 times since January 2019
Visitors: 2389