View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_87 (Length: 339)
Name: NF0214_low_87
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_low_87 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 6e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 6e-96
Query Start/End: Original strand, 78 - 289
Target Start/End: Original strand, 43928254 - 43928463
Alignment:
Q |
78 |
atgaagcggagataaaaaccagaaggaaatgtaaaacaagaacaaggattgaaatcaaaacatattaaagaaaagttatatnnnnnnntaaaaggatttt |
177 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
43928254 |
atgaagcggagataaaaaccagaaggaaatgtaaaacaagaagaaggattgaaatcaaaacatattaaagaaaagttatataaaaa--taaaaggatttt |
43928351 |
T |
 |
Q |
178 |
tggttttgcagagttggaatggaacttcttcacaaaccaactaactgcgcgcaacctgcaacggtctgtgatcctctgctttgtcatttttccccttcct |
277 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
43928352 |
tggttttgcagagttggaatggaacttcttcacaaaccaactaactgcgcgcaacctgcaacggtctgtgatcctctgctttgtcattttcccccttcct |
43928451 |
T |
 |
Q |
278 |
ctaactcccaat |
289 |
Q |
|
|
|||||||||||| |
|
|
T |
43928452 |
ctaactcccaat |
43928463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University