View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0214_low_90 (Length: 333)

Name: NF0214_low_90
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0214_low_90
NF0214_low_90
[»] chr4 (2 HSPs)
chr4 (98-177)||(48600427-48600506)
chr4 (231-266)||(48600338-48600373)


Alignment Details
Target: chr4 (Bit Score: 80; Significance: 2e-37; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 98 - 177
Target Start/End: Complemental strand, 48600506 - 48600427
Alignment:
98 caatgctctcaagatcactcttctccttctccttgtttccgctattgttgtcgcttgctttactctcccaattgaaaagg 177  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48600506 caatgctctcaagatcactcttctccttctccttgtttccgctattgttgtcgcttgctttactctcccaattgaaaagg 48600427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 231 - 266
Target Start/End: Complemental strand, 48600373 - 48600338
Alignment:
231 attatcgttcatgatgttctaatggggtgacttcat 266  Q
    ||||||||||||||||||||||||||||||||||||    
48600373 attatcgttcatgatgttctaatggggtgacttcat 48600338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1404 times since January 2019
Visitors: 2391