View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_92 (Length: 326)
Name: NF0214_low_92
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_low_92 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 30 - 203
Target Start/End: Complemental strand, 38319319 - 38319148
Alignment:
| Q |
30 |
gccactacttgcagcttccatgtatattgattaaaaattaccataaattgaaccacatttatttttctaaccggaattttatgtaaacaacgcagtatct |
129 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38319319 |
gccactacttgcagcttccatgtat--tgattaaaaattaccataaattgaatcacatttatttttctaaccggaattttatgtaaacaacgcagtatct |
38319222 |
T |
 |
| Q |
130 |
tgaccttatatttataatcttgatatcaaataatgaaatgctttcatgaattagcaagaagaacaatgtcaaag |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38319221 |
tgaccttatatttataatcttgatatcaaataatgaaatgctttcatgaattagcaagaagaacaatgtcaaag |
38319148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 258 - 298
Target Start/End: Complemental strand, 38319123 - 38319083
Alignment:
| Q |
258 |
gaggtattcgggtattctggacttgctgaaggagtggctac |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38319123 |
gaggtattcgggtattctggacttgctgaaggagtggctac |
38319083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University