View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0214_low_92 (Length: 326)

Name: NF0214_low_92
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0214_low_92
NF0214_low_92
[»] chr8 (2 HSPs)
chr8 (30-203)||(38319148-38319319)
chr8 (258-298)||(38319083-38319123)


Alignment Details
Target: chr8 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 30 - 203
Target Start/End: Complemental strand, 38319319 - 38319148
Alignment:
30 gccactacttgcagcttccatgtatattgattaaaaattaccataaattgaaccacatttatttttctaaccggaattttatgtaaacaacgcagtatct 129  Q
    |||||||||||||||||||||||||  ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
38319319 gccactacttgcagcttccatgtat--tgattaaaaattaccataaattgaatcacatttatttttctaaccggaattttatgtaaacaacgcagtatct 38319222  T
130 tgaccttatatttataatcttgatatcaaataatgaaatgctttcatgaattagcaagaagaacaatgtcaaag 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38319221 tgaccttatatttataatcttgatatcaaataatgaaatgctttcatgaattagcaagaagaacaatgtcaaag 38319148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 258 - 298
Target Start/End: Complemental strand, 38319123 - 38319083
Alignment:
258 gaggtattcgggtattctggacttgctgaaggagtggctac 298  Q
    |||||||||||||||||||||||||||||||||||||||||    
38319123 gaggtattcgggtattctggacttgctgaaggagtggctac 38319083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1002 times since January 2019
Visitors: 2388