View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_93 (Length: 319)
Name: NF0214_low_93
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_low_93 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 2e-61; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 84 - 223
Target Start/End: Complemental strand, 36991328 - 36991189
Alignment:
Q |
84 |
cacagaaaaagcaacaattaggcctaccggctgcaccctcagtttttcaatgggatattggtagatattcatgttcttcattgttatgtgggtgtaccaa |
183 |
Q |
|
|
||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
36991328 |
cacagcaaaagcgacaattaggcctaccggctgcaccctcagtttttcaatgggatattggtagatattcatgttcttcattgttacgtgggtgtaccaa |
36991229 |
T |
 |
Q |
184 |
agtatacctccagccattagatcaagtagagatctaaagt |
223 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
36991228 |
agtatactaccagccattagatcaagtagagatctaaagt |
36991189 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 84 - 223
Target Start/End: Complemental strand, 37016768 - 37016629
Alignment:
Q |
84 |
cacagaaaaagcaacaattaggcctaccggctgcaccctcagtttttcaatgggatattggtagatattcatgttcttcattgttatgtgggtgtaccaa |
183 |
Q |
|
|
||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
37016768 |
cacagcaaaagcgacaattaggcctaccggctgcaccctcagtttttcaatgggatattggtagatattcatgttcttcattgttacgtgggtgtaccaa |
37016669 |
T |
 |
Q |
184 |
agtatacctccagccattagatcaagtagagatctaaagt |
223 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
37016668 |
agtatactaccagccattagatcaagtagagatctaaagt |
37016629 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 96 - 215
Target Start/End: Original strand, 28296212 - 28296331
Alignment:
Q |
96 |
aacaattaggcctaccggctgcaccctcagtttttcaatgggatattggtagatattcatgttcttcattgttatgtgggtgtaccaaagtatacctcca |
195 |
Q |
|
|
|||||||| |||||| |||||||||||||| ||| | |||||||| || |||||||| ||||||||||||| |||||| ||||||||||||||||| ||| |
|
|
T |
28296212 |
aacaattatgcctactggctgcaccctcagctttccgatgggatactgatagatatttatgttcttcattgctatgtgagtgtaccaaagtataccacca |
28296311 |
T |
 |
Q |
196 |
gccattagatcaagtagaga |
215 |
Q |
|
|
|||||||||||||| ||||| |
|
|
T |
28296312 |
gccattagatcaagcagaga |
28296331 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University
This website was viewed 1436 times since January 2019
Visitors: 3726