View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0214_low_99 (Length: 314)

Name: NF0214_low_99
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0214_low_99
NF0214_low_99
[»] chr4 (2 HSPs)
chr4 (92-242)||(38085636-38085786)
chr4 (100-153)||(38081309-38081362)


Alignment Details
Target: chr4 (Bit Score: 126; Significance: 6e-65; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 92 - 242
Target Start/End: Complemental strand, 38085786 - 38085636
Alignment:
92 agatttaaatgaaaataaaatagcaattagtacaatagacaagtatgagcctagatgcatcannnnnnngttagtgtagtgttgtgcataagatgcttca 191  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||    
38085786 agatgtaaatgaaaataaaatagcaattagtacaatagacaagtatgagcctagatgcatcatttttttgttagtgtagtgttgtgcataagatgcttca 38085687  T
192 aatttataagtgtcactctatgctctaatttttattggtatatagaataat 242  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
38085686 aatttataagtgtcactctatgctctaatttttattggtatatagaataat 38085636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 100 - 153
Target Start/End: Complemental strand, 38081362 - 38081309
Alignment:
100 atgaaaataaaatagcaattagtacaatagacaagtatgagcctagatgcatca 153  Q
    ||||||||||||||||||| ||| ||| |||||| ||||||| |||| ||||||    
38081362 atgaaaataaaatagcaataagtgcaacagacaaatatgagcttagaggcatca 38081309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University