View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_low_99 (Length: 314)
Name: NF0214_low_99
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_low_99 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 6e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 92 - 242
Target Start/End: Complemental strand, 38085786 - 38085636
Alignment:
| Q |
92 |
agatttaaatgaaaataaaatagcaattagtacaatagacaagtatgagcctagatgcatcannnnnnngttagtgtagtgttgtgcataagatgcttca |
191 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38085786 |
agatgtaaatgaaaataaaatagcaattagtacaatagacaagtatgagcctagatgcatcatttttttgttagtgtagtgttgtgcataagatgcttca |
38085687 |
T |
 |
| Q |
192 |
aatttataagtgtcactctatgctctaatttttattggtatatagaataat |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38085686 |
aatttataagtgtcactctatgctctaatttttattggtatatagaataat |
38085636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 100 - 153
Target Start/End: Complemental strand, 38081362 - 38081309
Alignment:
| Q |
100 |
atgaaaataaaatagcaattagtacaatagacaagtatgagcctagatgcatca |
153 |
Q |
| |
|
||||||||||||||||||| ||| ||| |||||| ||||||| |||| |||||| |
|
|
| T |
38081362 |
atgaaaataaaatagcaataagtgcaacagacaaatatgagcttagaggcatca |
38081309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University