View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0215-INSERTION-2 (Length: 487)
Name: NF0215-INSERTION-2
Description: NF0215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0215-INSERTION-2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 7e-87; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 7e-87
Query Start/End: Original strand, 184 - 354
Target Start/End: Original strand, 37247457 - 37247627
Alignment:
Q |
184 |
cttgaattttctgtctttaatctcgaagttgatgccccttaatcactgctaagaaagtggtacatctccttcaacaggaaaattggtagccacgacaaca |
283 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37247457 |
cttgaattttccgtctttaatctcgaagttgatgccccttaatcactgctaagaaagtggtacatctccttcaacaggaaaattggtagccacgacaaca |
37247556 |
T |
 |
Q |
284 |
ttaaataaagtaaatctggtgacactttataactggtcaatcccgttaaatgggtcaatatttgacaacaa |
354 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
37247557 |
ttaaataaagtaaatctggtgacactttataactggtcaatcccgttaattgggtcaatatttgacaacaa |
37247627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 151; E-Value: 1e-79
Query Start/End: Original strand, 8 - 162
Target Start/End: Original strand, 37247313 - 37247467
Alignment:
Q |
8 |
ctatagaatattaaatatttttgtaatttgtgtgtacgttgtgtagtcatgcacctggtcacgatatactagatggagtaatatgtttcaagcaaaggaa |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
37247313 |
ctatagaatattaaatatttttgtaatttgtgtgtacgttgtgtagtcatgcacctggtcacgatatactagatggagtaatatgtttcaagtaaaggaa |
37247412 |
T |
 |
Q |
108 |
tttttagttttattattttgaaaacacaaagtaaaggtttaaaacttgaattttc |
162 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37247413 |
tttttagttttattattttgaaaacacaaagtaaaggtttaaaacttgaattttc |
37247467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1005 times since January 2019
Visitors: 2388