View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0215_low_1 (Length: 411)
Name: NF0215_low_1
Description: NF0215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0215_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 8 - 307
Target Start/End: Complemental strand, 48397814 - 48397515
Alignment:
| Q |
8 |
cagcagagatagtatgagtttcagagagagtgttgaagttttgacggagagaagggagagaacggaggacagtgagggagatgattgtctctatcccgga |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48397814 |
cagcagtgatagtatgagtttcagagagagtgttgaagttttgacggagagaagggagagaacggaggacagtgagggagatgattgtctctatcccgga |
48397715 |
T |
 |
| Q |
108 |
gtttggtggaaggtctgagaaggaaactggtggaaggaaagtatgtgaaatggactttggtagagattgaagaactgttttttgagcttttgaaggtgga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48397714 |
gtttggtggaaggtctgagaaggaaactggtggaaggaaagtatgtgaaatgaactttggtagagattgaagaactgttttttgagcttttgaaggtgga |
48397615 |
T |
 |
| Q |
208 |
ccttcggtgggaatgaagaaggagatttgaagattttgattaagaataataattcttttggcaaattcaatcattggtataagatgtcccatgcctggtg |
307 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48397614 |
ccttcggtgggaatgaagaaggtgatttgaagattttgattaagaataataattcttttggcaaattcaatcattggtataagatgtcccatgcctggtg |
48397515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University