View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0215_low_4 (Length: 317)
Name: NF0215_low_4
Description: NF0215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0215_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 39 - 302
Target Start/End: Complemental strand, 44709225 - 44708962
Alignment:
| Q |
39 |
ctatggtcttgtcactggtcagtaaaagctccgcctttagtttgatattcatattatgtttaaaaatgatccataatggctctttttgaatggctgcaaa |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44709225 |
ctatggtcttgtcactggtcagtaaaagctccgcctttagtttgatattcatattatgtttaaaaatgatccataatggctctttttgaatggctgcaaa |
44709126 |
T |
|
| Q |
139 |
tcgcaatgtccccggttttggtgtgacaagatcattgtcagatgaatcagtgacaacatatattttgccagctttgcctcctgttgtgccgtgaccaaaa |
238 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44709125 |
tcgcaatgtccctggttttggtgtgacaagatcattgtcagatgaatcagtgacaacatatattttgccagctttgcctcctgttgtgccgtgaccaaaa |
44709026 |
T |
|
| Q |
239 |
ccaagaacacaatctgctagcttcttgcgattcttttcccaatttggatcacatctccagcaac |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44709025 |
ccaagaacacaatctgctagcttcttgcgattcttttcccaatttggatcacatctccagcaac |
44708962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1102 times since January 2019
Visitors: 2389