View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0215_low_5 (Length: 294)
Name: NF0215_low_5
Description: NF0215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0215_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 30 - 284
Target Start/End: Complemental strand, 40505989 - 40505735
Alignment:
| Q |
30 |
catttcttcttcattgcattttccaccaaaatcaataaagttacattttttacaatacgggtcattgtttttcctaatgttaacgttaattctgatcatg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40505989 |
catttcttcttcattgcattttccaccaaaatcaataaagttacattttttacaatacgggtaattgtttttcctaatgttaacgttaattctgatcatg |
40505890 |
T |
|
| Q |
130 |
gattgaggaatgtataaatctatgatttagtgcttgttgggtttgattgattgtaggaataggaattaaggaagctgttgaaacagaaaaagcacctgct |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40505889 |
gattgaggaatgtataaatctatgatttagtgcttgttgggtttgattgattgtaggaataggaattaaggaagctgttgaaacagaaaaagcacctgct |
40505790 |
T |
|
| Q |
230 |
gctttgggaacatattctcaagcaaacaaagtcaacaacattctttttgtctctg |
284 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40505789 |
gctttgggaccatattctcaagcaaacaaagtcaacaacattctttttgtctctg |
40505735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 197 - 282
Target Start/End: Complemental strand, 20483172 - 20483087
Alignment:
| Q |
197 |
aaggaagctgttgaaacagaaaaagcacctgctgctttgggaacatattctcaagcaaacaaagtcaacaacattctttttgtctc |
282 |
Q |
| |
|
|||||||||||| ||||||||||| || || || |||||| | ||||||||||||| ||||| ||||||| |||| |||||||| |
|
|
| T |
20483172 |
aaggaagctgtttcgacagaaaaagccccagcagcattgggaccgtattctcaagcaatcaaagccaacaaccttctatttgtctc |
20483087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1149 times since January 2019
Visitors: 2389