View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0215_low_7 (Length: 273)
Name: NF0215_low_7
Description: NF0215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0215_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 27 - 209
Target Start/End: Complemental strand, 2398526 - 2398344
Alignment:
| Q |
27 |
aggagcagagagtgaattatctgaaacatctatgaatagcattcctacccaagagccaagcttttgtggaagaaaaccagtgagtttgttatcataaaga |
126 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2398526 |
aggaccagaaagtgaattatctgaaacatctatgaatagcattcctacccaagaaccaagcttttgtggaagaaaaccagtgagtttgttatcataaaga |
2398427 |
T |
 |
| Q |
127 |
gaaagttctgtaagattcttaaaatctccaaactcttgtggaatttctcctgagaatttgttctgaaaaagctgaagagattg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2398426 |
gaaagttctgtaagattcttaaaatctccaaactcttgtggaatttctcctgagaatttgttctgaaaaagctgaagagattg |
2398344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University