View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0216-INSERTION-3 (Length: 419)
Name: NF0216-INSERTION-3
Description: NF0216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0216-INSERTION-3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 366; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 366; E-Value: 0
Query Start/End: Original strand, 7 - 418
Target Start/End: Original strand, 34843009 - 34843420
Alignment:
| Q |
7 |
agaatggatcctgataataggtgataacagtataaactattgaaatgattgaaacatattaaggaannnnnnnagtgtatatgccgaatacaactcccaa |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34843009 |
agaatggatcctgataataggtgataacagtataaactattgaaatgattggaacatattaaggaatttttttagtgtatatgccgaatacaactcccaa |
34843108 |
T |
 |
| Q |
107 |
tttcctcatctatacaaaatgattattgcttaatttctgttgctaatcttgacttaaggaaagtgataactctttgcaaaattaaaaggccatcaaggat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34843109 |
tttcctcatctatacaaaatgattattgcttaatttctgttgctaatcttgacttaaggaaagtgataactctttgcaaaattaaaaggccatcaaggat |
34843208 |
T |
 |
| Q |
207 |
tnnnnnnntggtgtgacatagctatcaagatctttggcatccaccaaagtagaacctttggattgagacaagttataggatgcaaatgttgcaaatttat |
306 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34843209 |
taaaaaaatggtgtgacatagctatcaagatctttggcatccaccaaagtagaacctttggattgagacaagttataggatgcaaatgttgcaaatttat |
34843308 |
T |
 |
| Q |
307 |
tggagtggaattatttattgagtaacaaagtgcttgtacattggacatttttagtaaaaatttcatccagctacttgataatttagtgatgtaatctatc |
406 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34843309 |
tggagtggaattatttattgagtaacaaagtgcttgtacattggacatttttagtaaaaatttcatccagctacttgataatttagtgatgtaatctatc |
34843408 |
T |
 |
| Q |
407 |
ttttcagtataa |
418 |
Q |
| |
|
|||||||||||| |
|
|
| T |
34843409 |
ttttcagtataa |
34843420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University