View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0216_high_12 (Length: 285)
Name: NF0216_high_12
Description: NF0216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0216_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 55 - 221
Target Start/End: Complemental strand, 43206324 - 43206154
Alignment:
| Q |
55 |
tgaaggtgatggacttgacaaaacctatattaaagataaagtttgttaaaaatagttaattagtttgctcattctttttcatatgctttcttgtattatt |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43206324 |
tgaaggtgatggacttgacaaaacctatattagagataaagtttgttaaaaatagttaattagtttgctcattctttttcatatgctttattgtattatt |
43206225 |
T |
 |
| Q |
155 |
gattag----taataacctgaagtggaggtttcgttgaaggtgtcaatgagagtatgatgagaggagagat |
221 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43206224 |
gattagtaattaataacctgaagtggaggtttcgttgaaggtgtcaatgagagtatgatgagaggagagat |
43206154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University