View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0216_high_5 (Length: 384)
Name: NF0216_high_5
Description: NF0216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0216_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 13 - 379
Target Start/End: Original strand, 39893066 - 39893434
Alignment:
Q |
13 |
aatatcgtatcgagaatgcaaatgatcctcttgtatatagttgaggatcagattttcagtaatgatggttgtgtagctattggtcgacaattatagacag |
112 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39893066 |
aatatcgtatcgagaatgcaaatgatcctcttatatatagttgaggatcggattttcagtaatgatggttgtgtagctattggtcgacaattatagacag |
39893165 |
T |
 |
Q |
113 |
tgtggtctgtaaatgttaagcgttacaaagtaatgaaggtgggaacattacagttcatggttgggccgaacgtctcctactattgagaacacacctccct |
212 |
Q |
|
|
|||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||||||||||||| |
|
|
T |
39893166 |
tgtggtctgtaaatattgagcgttacaaagtaatgaaggtgggaacattacagttcatggttgggccaaatgtctcctactattgcgaacacacctccct |
39893265 |
T |
 |
Q |
213 |
ggtgaggggagggtgtgcatagctttgttgggccaatgcgtctaacatatggattgtcgagcataacctttgacacgtcgagcatgagccttggttcgtc |
312 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
39893266 |
ggtgaggggagggtgtgcatagctttgttgggccaatgcgtctaacatatggattgtcgagcataagctttgacacgtcgagcatgagccttggttcgtc |
39893365 |
T |
 |
Q |
313 |
gagcacatctcttaaaccgccgaacacaatattgaacatagccct--agctgttgcgcatggaccttat |
379 |
Q |
|
|
||||||||||||||||| ||||||||||| ||||||||||||||| | |||| | ||||||||||||| |
|
|
T |
39893366 |
gagcacatctcttaaactgccgaacacaacattgaacatagcccttgaactgtcgagcatggaccttat |
39893434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University