View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0216_low_15 (Length: 249)
Name: NF0216_low_15
Description: NF0216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0216_low_15 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 24 - 249
Target Start/End: Complemental strand, 8317337 - 8317112
Alignment:
| Q |
24 |
gatcgaacaaatgaattagttgtgctgtaccatacccagagtaagtgaattgcttgagatgcaaagcattgaatttgatggattggctatgtaggtcatg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8317337 |
gatcgaacaaatgaattagttgtgctgtaccatacccagagtaagtgaattgcttgagatgcaaagcattgaatttgatggattggctatgtaggtcatg |
8317238 |
T |
 |
| Q |
124 |
ggatgccgcataataaaattcaatgtcttgttctatggaaacaatttcaagtagaggagcttctaaaataagatcttttccacccgcccaattgcagttt |
223 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
8317237 |
ggatgccgcattataaaattcaatgtcttgttctatggaaacaatttcaagtagaggagcttctacaataagatcttttccacccgaccaattgcagttt |
8317138 |
T |
 |
| Q |
224 |
ttgatatcgaactttctaggaagtgg |
249 |
Q |
| |
|
|||||||| ||||||||| ||||||| |
|
|
| T |
8317137 |
ttgatatcaaactttctaagaagtgg |
8317112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 148 - 231
Target Start/End: Original strand, 8358987 - 8359070
Alignment:
| Q |
148 |
gtcttgttctatggaaacaatttcaagtagaggagcttctaaaataagatcttttccacccgcccaattgcagtttttgatatc |
231 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||| || ||||||||||||| ||| |||| |||||||||| ||||| |
|
|
| T |
8358987 |
gtcttgttctatggaaatgttttcaagaagaggagcttgtacgataagatcttttctaccacaccaaatgcagtttttaatatc |
8359070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University