View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0216_low_17 (Length: 210)
Name: NF0216_low_17
Description: NF0216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0216_low_17 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 115 - 210
Target Start/End: Original strand, 39893336 - 39893431
Alignment:
| Q |
115 |
tgacacgtcgagcatgagccttggttcgtcgagcacatctcttaaaccgccgaacacaatattgaacatagcccttgaactgttgagcatggacct |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39893336 |
tgacacgtcgagcatgagccttggttcgtcgagcacatctcttaaactgccgaacacaacattgaacatagcccttgaactgtcgagcatggacct |
39893431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1826 times since January 2019
Visitors: 2393