View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0216_low_9 (Length: 318)

Name: NF0216_low_9
Description: NF0216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0216_low_9
NF0216_low_9
[»] chr5 (4 HSPs)
chr5 (202-278)||(32317972-32318048)
chr5 (1-83)||(32317848-32317936)
chr5 (1-83)||(32306304-32306394)
chr5 (219-251)||(32306187-32306219)


Alignment Details
Target: chr5 (Bit Score: 69; Significance: 6e-31; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 202 - 278
Target Start/End: Original strand, 32317972 - 32318048
Alignment:
202 atgcagcgtcatatgttatgcccgaaaagcacatacttgaatcggtccttgatgtcctacaaaggtgaaaactatat 278  Q
    |||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
32317972 atgcagtgtcatatgttatgcccgaaaagcacatacttgaatcagtccttgatgtcctacaaaggtgaaaactatat 32318048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 32317848 - 32317936
Alignment:
1 accctcagagtggaagtacttcacaaacacatggtaagc------ttagtgtaattatctcacataaattgtacacttttcacataatt 83  Q
    |||||||||||||||||||||||||||||||||||||||      ||| | ||||||||||||||||||||||||||||||||||||||    
32317848 accctcagagtggaagtacttcacaaacacatggtaagctttagtttaatataattatctcacataaattgtacacttttcacataatt 32317936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 32306394 - 32306304
Alignment:
1 accctcagagtggaagtacttcacaaacacatggtaagcttagtgta--------attatctcacataaattgtacacttttcacataatt 83  Q
    |||||||||||||  ||||||||||||||||||||||||||||| ||        ||||| ||||||||||||||||||||||||||||||    
32306394 accctcagagtggcggtacttcacaaacacatggtaagcttagtttaatataattattatatcacataaattgtacacttttcacataatt 32306304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 219 - 251
Target Start/End: Complemental strand, 32306219 - 32306187
Alignment:
219 atgcccgaaaagcacatacttgaatcggtcctt 251  Q
    |||||||||||||||||||||||||| ||||||    
32306219 atgcccgaaaagcacatacttgaatcagtcctt 32306187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1434 times since January 2019
Visitors: 2391