View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0216_low_9 (Length: 318)
Name: NF0216_low_9
Description: NF0216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0216_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 69; Significance: 6e-31; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 202 - 278
Target Start/End: Original strand, 32317972 - 32318048
Alignment:
Q |
202 |
atgcagcgtcatatgttatgcccgaaaagcacatacttgaatcggtccttgatgtcctacaaaggtgaaaactatat |
278 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
32317972 |
atgcagtgtcatatgttatgcccgaaaagcacatacttgaatcagtccttgatgtcctacaaaggtgaaaactatat |
32318048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 32317848 - 32317936
Alignment:
Q |
1 |
accctcagagtggaagtacttcacaaacacatggtaagc------ttagtgtaattatctcacataaattgtacacttttcacataatt |
83 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| ||| | |||||||||||||||||||||||||||||||||||||| |
|
|
T |
32317848 |
accctcagagtggaagtacttcacaaacacatggtaagctttagtttaatataattatctcacataaattgtacacttttcacataatt |
32317936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 32306394 - 32306304
Alignment:
Q |
1 |
accctcagagtggaagtacttcacaaacacatggtaagcttagtgta--------attatctcacataaattgtacacttttcacataatt |
83 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||| || ||||| |||||||||||||||||||||||||||||| |
|
|
T |
32306394 |
accctcagagtggcggtacttcacaaacacatggtaagcttagtttaatataattattatatcacataaattgtacacttttcacataatt |
32306304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 219 - 251
Target Start/End: Complemental strand, 32306219 - 32306187
Alignment:
Q |
219 |
atgcccgaaaagcacatacttgaatcggtcctt |
251 |
Q |
|
|
|||||||||||||||||||||||||| |||||| |
|
|
T |
32306219 |
atgcccgaaaagcacatacttgaatcagtcctt |
32306187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University