View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0217Ase1 (Length: 269)
Name: NF0217Ase1
Description: NF0217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0217Ase1 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 39 - 242
Target Start/End: Complemental strand, 863267 - 863060
Alignment:
| Q |
39 |
tggtaatgatcaatgtaataatatttttgttcatagtcttcattttaagagagaga------tacaaagtgaaaggtggaaggatttcaa-tagaagaga |
131 |
Q |
| |
|
|||||||||||||||||||| | ||| ||||||||||||||||||||| |||| || |||||||| ||||||||||||||||||| ||||||| | |
|
|
| T |
863267 |
tggtaatgatcaatgtaatagtgtttatgttcatagtcttcattttaaaagagggagaggtatacaaagtaaaaggtggaaggatttcaaatagaagata |
863168 |
T |
|
| Q |
132 |
ttttctttagttgacatatataaaaaaggaatttgaagttctatttatagggaagaaaacactatgcacgcatgagctacacagtaaagatgcatgcatt |
231 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
863167 |
ttttctttagttgacatatacaaa---ggaatttgaagttctatttatagggaagaaaatactatgcacacatgagctacacagtgaagatgcatgcatt |
863071 |
T |
|
| Q |
232 |
tgatgtaattc |
242 |
Q |
| |
|
||||||||||| |
|
|
| T |
863070 |
tgatgtaattc |
863060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1652 times since January 2019
Visitors: 2392