View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0217Ase13 (Length: 397)
Name: NF0217Ase13
Description: NF0217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0217Ase13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 8e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 8e-74
Query Start/End: Original strand, 10 - 170
Target Start/End: Complemental strand, 24497277 - 24497117
Alignment:
| Q |
10 |
aagaaccctatatggtttcggaggttgatgaagaaaaacaagatgccctcttatgtgtattatgcttttaaatttgttattagaacatgtaattgttctt |
109 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24497277 |
aagaaccctctatggttttggaggttgatgaagaaaaacaagaagccctcttatgtgtattatgcttttaactttgttattagaacatgtaattgttctt |
24497178 |
T |
 |
| Q |
110 |
taaaatgcttatttagattgttcctttgtaagtttcaataagatttgaatctaatgaagta |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24497177 |
taaaatgcttatttagattgttcctttgtaagtttcaacaagatttgaatctaatgaagta |
24497117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 92 - 167
Target Start/End: Original strand, 24982285 - 24982360
Alignment:
| Q |
92 |
gaacatgtaattgttctttaaaatgcttatttagattgttcctttgtaagtttcaataagatttgaatctaatgaa |
167 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24982285 |
gaacatgtgattgttctttaaaatgcttatttggattgttcctttgtaagtttcaacaagatttgaatctaatgaa |
24982360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University