View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0217Ase16 (Length: 252)
Name: NF0217Ase16
Description: NF0217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0217Ase16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 7 - 243
Target Start/End: Complemental strand, 52823955 - 52823720
Alignment:
| Q |
7 |
taatactatatagtctctttctatatataacaagtttagtatgcataaatattggagagaattacgaggcaaatatcgcagagagggaaatggttgggag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52823955 |
taatactatatagtctctttctatatataacaagattagtatacataaatattggagagaattacgaggcaaatatcgcagagagggaaatggttgggag |
52823856 |
T |
|
| Q |
107 |
aattagggtggtcgagagagaagcgacggtgtttggaggcgagtttgttagcatggtggacacggtgggtcgcaggtggagcataaggcagcttcatcgg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52823855 |
aattagggtggtcgagagagaagcgacggtgtttggaggcgagtttgttagcatggtggacacggt-ggtcgcaggtggagcataaggcagcttcatcgg |
52823757 |
T |
|
| Q |
207 |
cggtgcaaaataaagaagcctgccgtttgttacagac |
243 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
52823756 |
cggtgcagaataaagaagcctgccgtttgttacagac |
52823720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2004 times since January 2019
Visitors: 2396