View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0217Ase2 (Length: 272)
Name: NF0217Ase2
Description: NF0217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0217Ase2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 7 - 255
Target Start/End: Original strand, 33570513 - 33570761
Alignment:
| Q |
7 |
taatttgcgcaatcatcgattttttcttcttagggtatcagaaaggatgtcgaggaacctacattttaagttatgatgaagaaatggaccatcatcacta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
33570513 |
taatttgcgcaatcatcgattttttcttcttagggtatcagaaaggatgtcgaggaacctacattttaagttatgataaaaaaatggaccatcatcacta |
33570612 |
T |
 |
| Q |
107 |
caaatctactcaatcattgcaaatgaagaggatatgttcttaaacagcaaataaacgacgcattcatcgtttcatataatattgttatgcttttgccttg |
206 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||| || ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33570613 |
caaatctactcaatcattgcaaataaaaaggatatttttttaaacagcaaataaacaacccattcatcgtttcatataatattgttatgcttttgccttg |
33570712 |
T |
 |
| Q |
207 |
ttgcttccttttctctcattagtttcttatgggaatatttatatttttt |
255 |
Q |
| |
|
||||||||||||||||||| ||||||| |||| | |||| ||||||| |
|
|
| T |
33570713 |
ttgcttccttttctctcatgggtttcttgggggattttttagatttttt |
33570761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University