View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0217Ase25 (Length: 172)
Name: NF0217Ase25
Description: NF0217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0217Ase25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 7 - 164
Target Start/End: Original strand, 52709574 - 52709731
Alignment:
| Q |
7 |
taatgtctttctatttaatctccatcaacagctctgtcacacattatgaactagctataattcaaatagattttccaaaaatagaatcgctgtaatccca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52709574 |
taatgtctttctatttaatctccatcaacagctctgtcacacattatgaactagctataattcaaatagattttccaaaaatagaatcgctgtaatccca |
52709673 |
T |
 |
| Q |
107 |
aatagctgtttctnnnnnnntgaaaagctttaattgcaatgaaaatgtactactataa |
164 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52709674 |
aatagctgtttctaaaaaaatgaaaagctgtaattgcaatgaaaatgtactactataa |
52709731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University