View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0217Ase5 (Length: 114)

Name: NF0217Ase5
Description: NF0217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0217Ase5
NF0217Ase5
[»] chr1 (1 HSPs)
chr1 (7-99)||(41158363-41158457)


Alignment Details
Target: chr1 (Bit Score: 80; Significance: 5e-38; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 80; E-Value: 5e-38
Query Start/End: Original strand, 7 - 99
Target Start/End: Complemental strand, 41158457 - 41158363
Alignment:
7 taataatgacacagagaatgacaa--ctaaaattgtacccttttttgttattgtttgtttcttatgcattttattatctcgtgaggcatcaatgg 99  Q
    ||||||||||||||||||||||||  ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41158457 taataatgacacagagaatgacaaaactaaaattggacccttttttgttattgtttgtttcttatgcattttattatctcgtgaggcatcaatgg 41158363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University