View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0217Eco1 (Length: 99)
Name: NF0217Eco1
Description: NF0217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0217Eco1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 81; Significance: 1e-38; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 81; E-Value: 1e-38
Query Start/End: Original strand, 4 - 92
Target Start/End: Complemental strand, 31095752 - 31095664
Alignment:
Q |
4 |
caattatccactgtgacatgtttccagagttagaaccaccaccataagacaccttggctggtggaaaatctccaaatcctccggcttcg |
92 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
31095752 |
caattgtccactgtgacatgtttccagagttagaaccaccaccataagacaccttggctggtggaaaatctccaaaccctccggcttcg |
31095664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1425 times since January 2019
Visitors: 2391