View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0217Eco2 (Length: 225)
Name: NF0217Eco2
Description: NF0217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0217Eco2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 82 - 222
Target Start/End: Complemental strand, 3519082 - 3518942
Alignment:
| Q |
82 |
ctataatatgtctgaactataaacctgatgttttagccgggaatttttctaccacaatgtgatcaaaatagcaaatgccaaaataatttgaaatgatgat |
181 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3519082 |
ctataatgtgtctgaactatatgcctgatgttttagccgggaatttttctaccacaatgtgatcaaagtagcaaatgccaaaataatttgaaatgatgat |
3518983 |
T |
 |
| Q |
182 |
gatcccgatagacatttataaatttgaagattaatcaattg |
222 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3518982 |
gatcccgatggacatttataaatttgaagattaatcaattg |
3518942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University