View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0217_low_4 (Length: 336)
Name: NF0217_low_4
Description: NF0217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0217_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 20 - 331
Target Start/End: Complemental strand, 22155315 - 22155004
Alignment:
Q |
20 |
gacatcatcatctctccttgcccaatccatgtcagaactgtccctatctttttgcctatcaaatccgtcagtatttgtatgcaattgatgggccaagcta |
119 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22155315 |
gacatcatcatctctccttgcccaatccatgtcagaactgtccctatctttttgcctatcaaatccgtcagtatttgtatgcaattgatgggccaagcta |
22155216 |
T |
 |
Q |
120 |
cgatgccggtccttgtaagggtatgatccatctctacctctaagtaccatgtgatttctttcgggatcttgctttccatcatgctcttttctatagaatc |
219 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22155215 |
cgatgccggtccttgtaagggtatgatccctctctacctctaagtaccatgtgatttctttcgggatcttgctttccatcatgctcttttctatagaatc |
22155116 |
T |
 |
Q |
220 |
cctgctcattttcatcagggtgttgtctgatgctagccagacgtgttgatcgtggatcctggactacttcttcatcaagaccctctcgtcgcttctgatt |
319 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22155115 |
cctgctcattttcatcagggtgttgtctgatgctagccagacgtgttgatcgtggatcctggactacttcttcatcaagaccctctcgtcgcttctgatt |
22155016 |
T |
 |
Q |
320 |
atctctgctgct |
331 |
Q |
|
|
|||||||||||| |
|
|
T |
22155015 |
atctctgctgct |
22155004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University