View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0217_low_5 (Length: 280)
Name: NF0217_low_5
Description: NF0217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0217_low_5 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 21 - 280
Target Start/End: Complemental strand, 11509793 - 11509534
Alignment:
| Q |
21 |
acatcatcaacaatggggttgacctgaaaaagcaaaaaggtatgattttgagagtgaaaaataaaaacccattagaggaagagtatgaaaaggggagaga |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11509793 |
acatcatcaacaatggggttgacctgaaaaagcaaaaaggtatgattttgagagtgaaaaataaaaacccattagaggaagagtatgaaaaggggagaga |
11509694 |
T |
 |
| Q |
121 |
aaggttacaatgtcgaaaacagaagagaaatcgatgcgtggacgagatttgagggagagaagttcggtttgagtgaggttggataaatggtaggttttga |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11509693 |
aaggttacaatgtcgaaaacagaagagaaatcgatgcgtggacgagatttgagggagagaagttcggtttgagtgaggttggataaatggtaggttttga |
11509594 |
T |
 |
| Q |
221 |
ttggatttgccatggaaatggaacagcgtgttcggtaattgatggtattgctaacagaga |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11509593 |
ttggatttgccatggaaatggaacagcgtgttcggtaattgatggtattggtaacagaga |
11509534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University