View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0217_low_6 (Length: 249)

Name: NF0217_low_6
Description: NF0217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0217_low_6
NF0217_low_6
[»] chr1 (1 HSPs)
chr1 (22-201)||(28525553-28525732)


Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 22 - 201
Target Start/End: Complemental strand, 28525732 - 28525553
Alignment:
22 cacagacatctttcttcactaaagattggaatgtgagatctattgccgctaaatcctcaacataatttataggccatttcactaagcatcccatatgaat 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
28525732 cacagacatctttcttcactaaagattggaatgtgagatctattgccgctaaatcctcaacataatttataggccatttcactaagcataccatatgaat 28525633  T
122 ttgatatgatggccatatcctagttcaaaaaaccctacataaatctttatcccaattaaaggaggatctttggtaccaat 201  Q
    |||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28525632 ttgatatgatggccatattctagttgaaaaaaccctacataaatctttatcccaattaaaggaggatctttggtaccaat 28525553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2490 times since January 2019
Visitors: 2401