View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0218-INSERTION3 (Length: 160)
Name: NF0218-INSERTION3
Description: NF0218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0218-INSERTION3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 87; Significance: 5e-42; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 5e-42
Query Start/End: Original strand, 8 - 158
Target Start/End: Complemental strand, 36864037 - 36863890
Alignment:
| Q |
8 |
cttgagacatgtgaacggtgtttgggatcttgtattgaacaagcataattttctgcnnnnnnngttgtatcactagtaagaatagtcatgtgataaatct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
36864037 |
cttgagacatgtgaacggtgtttgggatcttgtattgaacaagcataattttctgcaaaaaaagttgcatcaccagtaagaatagtcatgtgataaatct |
36863938 |
T |
 |
| Q |
108 |
atttactagggttggnnnnnnnnnngaaggaaaattaagtacattcatgat |
158 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36863937 |
atttactagggttgg---aaaaaaagaaggaaaattaagtacattcatgat |
36863890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University