View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0218-INSERTION5 (Length: 250)
Name: NF0218-INSERTION5
Description: NF0218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0218-INSERTION5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 99 - 225
Target Start/End: Original strand, 40372318 - 40372444
Alignment:
Q |
99 |
gcaggagtttgggtggtgatgctacaatagtatcttgttcaaatatatgaccttaagtagaagatgaaggggtagttgatcctcttgctcatcatgttct |
198 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
40372318 |
gcaggagtttgggtggtgatgctacaatagtatctcgttcaaatatatgaccttaagtagaagatgaaggggtagttgatcctcttggtcatcatgttct |
40372417 |
T |
 |
Q |
199 |
tcattccggttgttgatccttcgacat |
225 |
Q |
|
|
||||||||||||||||||||||||||| |
|
|
T |
40372418 |
tcattccggttgttgatccttcgacat |
40372444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University