View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0218_high_33 (Length: 325)
Name: NF0218_high_33
Description: NF0218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0218_high_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 88 - 314
Target Start/End: Original strand, 41531161 - 41531387
Alignment:
| Q |
88 |
gtctgatcagcacatctttgtgaacaaacgacatgtaagtaaccaagtatgcaactacttccaaagggaaaaacgtgtgtagaaactacctcatcctcat |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41531161 |
gtctgatcagcacatctttgtgaacaaacgacatgtaagtaaccaagtatgcaactacttccaaagggaaaaacgtgtgtagaaactacctcatcctcat |
41531260 |
T |
|
| Q |
188 |
gcctactattgtgttaccattggaatcttctatctataaattgaaagcaaaacattttattcatcacacacacaccaaaatcttaaatcgtctataacta |
287 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| ||||| ||||| ||||||||||| |
|
|
| T |
41531261 |
gcccactattgtgttaccattggaatcttctatctataaattgaaagcaaaacattttattcatcacataaacaccgaaatcataaattgtctataacta |
41531360 |
T |
|
| Q |
288 |
atatctttagtgtttttcatctcactc |
314 |
Q |
| |
|
|||||||||||||||||| |||||||| |
|
|
| T |
41531361 |
atatctttagtgtttttcctctcactc |
41531387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 132 - 175
Target Start/End: Original strand, 41232032 - 41232075
Alignment:
| Q |
132 |
aagtatgcaactacttccaaagggaaaaacgtgtgtagaaacta |
175 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| | |||||| |
|
|
| T |
41232032 |
aagtatgcaactacttccaaagggaaaaaagtgtgcataaacta |
41232075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1286 times since January 2019
Visitors: 2391