View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0218_high_34 (Length: 316)
Name: NF0218_high_34
Description: NF0218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0218_high_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 30 - 272
Target Start/End: Complemental strand, 27770477 - 27770237
Alignment:
| Q |
30 |
gtatgtgacaaaacttgcatatgaaaaacattaggaattagatcctctatcctttgagtg--tgtgagagagagggagtgagggtcaggagatcagagat |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| ||| ||||||||||||| |
|
|
| T |
27770477 |
gtatgtgacaaaacttgcatatgaaaaacattaggaattggatcctctatcctttgagtgtgtgtgagagagagggagggag-----ggagatcagagat |
27770383 |
T |
 |
| Q |
128 |
gtagaaagaaacatatgtgtctttcctactattaaggaagatgatccttgtctacaacattactcggttattaattaat---atgattcagaccgttcat |
224 |
Q |
| |
|
||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| | |
|
|
| T |
27770382 |
gtaaaaagaa--atatgtgtctttcctactattaaggaagatgatccttgtctacaacatttctcggttattaattaatcagatgattcagaccgttctt |
27770285 |
T |
 |
| Q |
225 |
gttttgattgagttgaaaccaaagaaaataaaatcttgttaattaggt |
272 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27770284 |
gttttgattgagttgaaaccaaacaaaataaaatcttgttaattaggt |
27770237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University