View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0218_high_36 (Length: 279)

Name: NF0218_high_36
Description: NF0218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0218_high_36
NF0218_high_36
[»] chr3 (2 HSPs)
chr3 (9-126)||(9800199-9800316)
chr3 (13-126)||(9801788-9801901)
[»] chr8 (1 HSPs)
chr8 (219-259)||(33548912-33548952)


Alignment Details
Target: chr3 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 9 - 126
Target Start/End: Complemental strand, 9800316 - 9800199
Alignment:
9 agctgctgctgtttccgcttttgctggtgttgcaatggcagatgaagaacctaaaagaggtaccccagaagccaagaaaaagtatgcccctgtttgtgtc 108  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
9800316 agctgctgctgtttccacttttgctggtgttgcaatggcagatgaagaacctaaaagaggtaccccagaagccaagaaaaagtacgcccctgtttgtgtc 9800217  T
109 actatggcaacagctagg 126  Q
    |||||| |||||||||||    
9800216 actatgccaacagctagg 9800199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 13 - 126
Target Start/End: Complemental strand, 9801901 - 9801788
Alignment:
13 gctgctgtttccgcttttgctggtgttgcaatggcagatgaagaacctaaaagaggtaccccagaagccaagaaaaagtatgcccctgtttgtgtcacta 112  Q
    |||||||||| | || ||||||| ||||||||||||||||| ||||| | ||||||||| |||||||||||||||||||||| |||||||||||||||||    
9801901 gctgctgtttgctctgttgctggggttgcaatggcagatgatgaaccaagaagaggtactccagaagccaagaaaaagtatggccctgtttgtgtcacta 9801802  T
113 tggcaacagctagg 126  Q
       |||||||||||    
9801801 acccaacagctagg 9801788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 219 - 259
Target Start/End: Complemental strand, 33548952 - 33548912
Alignment:
219 cttcattcattcaatttaataaataatacatcggacaacac 259  Q
    |||||||||||||||||||||||||||||||||||||||||    
33548952 cttcattcattcaatttaataaataatacatcggacaacac 33548912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University