View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0218_high_36 (Length: 279)
Name: NF0218_high_36
Description: NF0218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0218_high_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 9 - 126
Target Start/End: Complemental strand, 9800316 - 9800199
Alignment:
| Q |
9 |
agctgctgctgtttccgcttttgctggtgttgcaatggcagatgaagaacctaaaagaggtaccccagaagccaagaaaaagtatgcccctgtttgtgtc |
108 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9800316 |
agctgctgctgtttccacttttgctggtgttgcaatggcagatgaagaacctaaaagaggtaccccagaagccaagaaaaagtacgcccctgtttgtgtc |
9800217 |
T |
 |
| Q |
109 |
actatggcaacagctagg |
126 |
Q |
| |
|
|||||| ||||||||||| |
|
|
| T |
9800216 |
actatgccaacagctagg |
9800199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 13 - 126
Target Start/End: Complemental strand, 9801901 - 9801788
Alignment:
| Q |
13 |
gctgctgtttccgcttttgctggtgttgcaatggcagatgaagaacctaaaagaggtaccccagaagccaagaaaaagtatgcccctgtttgtgtcacta |
112 |
Q |
| |
|
|||||||||| | || ||||||| ||||||||||||||||| ||||| | ||||||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9801901 |
gctgctgtttgctctgttgctggggttgcaatggcagatgatgaaccaagaagaggtactccagaagccaagaaaaagtatggccctgtttgtgtcacta |
9801802 |
T |
 |
| Q |
113 |
tggcaacagctagg |
126 |
Q |
| |
|
||||||||||| |
|
|
| T |
9801801 |
acccaacagctagg |
9801788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 219 - 259
Target Start/End: Complemental strand, 33548952 - 33548912
Alignment:
| Q |
219 |
cttcattcattcaatttaataaataatacatcggacaacac |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33548952 |
cttcattcattcaatttaataaataatacatcggacaacac |
33548912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University