View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0218_high_42 (Length: 256)
Name: NF0218_high_42
Description: NF0218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0218_high_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 30 - 253
Target Start/End: Original strand, 33372401 - 33372621
Alignment:
Q |
30 |
ataatgtgcgtataactttttctggaaacacaaagtctaactaaaacaatgcaaattgtaatttttattgcttaaacattttaagaaaatatagtcaaac |
129 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33372401 |
ataatgtgcttataactttttctggaaacacaaagtctaactaaaacaatgcaaattgtaatttttattgcttaaacattttaagaaaatatagtcaaac |
33372500 |
T |
 |
Q |
130 |
agaatataatacaactaaaggcttttcagataatatattttttagaatacaattcaaaaatgacaatttgcttgaaagnnnnnnnnnnctcaatggcatg |
229 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
33372501 |
agaatataatacaactaaagtcttttcagataatatatttttcagaatacaattcaaaaatgacaatttgcttgaaa---aaaaaaaactcaatggcatg |
33372597 |
T |
 |
Q |
230 |
ttaattcattgtataatcagtttt |
253 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
33372598 |
ttaattcattgtataatcagtttt |
33372621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University