View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0218_high_48 (Length: 252)
Name: NF0218_high_48
Description: NF0218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0218_high_48 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 125 - 252
Target Start/End: Complemental strand, 33372908 - 33372782
Alignment:
| Q |
125 |
ttcaatgttacacattctattgttcnnnnnnntgttacacattttaagacaaattataaaaaggataataaatgcatttaaaaatttataaacagtctta |
224 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33372908 |
ttcaatgttacacattctattgttcaaaaaaatgttac-cattttaagacaaattagaaaaaggataataaatgcatttaaaaatttataaagagtctta |
33372810 |
T |
|
| Q |
225 |
tattcaaggataaaatatttattgtaaa |
252 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
33372809 |
tattcaaggataaaatatttattgtaaa |
33372782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 8 - 114
Target Start/End: Original strand, 25250887 - 25250993
Alignment:
| Q |
8 |
gagcagagagcttaccgtctgtttctattagagtcgcgagcttgttgtagtcggtccgtgaagggataacttgctgcttacttgctatatccccgcgttc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| ||| ||| | |||| |
|
|
| T |
25250887 |
gagcagagagcttaccgtctgtttctattagagtctcgagcttgttgtagtcggtccgtgaagggataacttgccgcttacttgatatgcccctgtgttc |
25250986 |
T |
|
| Q |
108 |
ttgcacg |
114 |
Q |
| |
|
||||||| |
|
|
| T |
25250987 |
ttgcacg |
25250993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 8 - 84
Target Start/End: Original strand, 19093711 - 19093787
Alignment:
| Q |
8 |
gagcagagagcttaccgtctgtttctattagagtcgcgagcttgttgtagtcggtccgtgaagggataacttgctgc |
84 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
19093711 |
gagcagagagcttaccgtcggtttctattagagtcgcgagcttgttgtagtcggaccatgaagggataacttgctgc |
19093787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 190 - 228
Target Start/End: Complemental strand, 10456786 - 10456748
Alignment:
| Q |
190 |
taataaatgcatttaaaaatttataaacagtcttatatt |
228 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
10456786 |
taataaatgcatctaaaaatttataaatagtcttatatt |
10456748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2252 times since January 2019
Visitors: 2400