View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0218_high_51 (Length: 252)
Name: NF0218_high_51
Description: NF0218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0218_high_51 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 15 - 88
Target Start/End: Complemental strand, 1347583 - 1347510
Alignment:
Q |
15 |
gtgagatgaatatttcctagatgtatacttggttttttcttaattttctatacctgctactattggatttgatg |
88 |
Q |
|
|
|||| ||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1347583 |
gtgatatgaatatttcctagatatatacttggtgttttcttaattttctatacctgctactattggatttgatg |
1347510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University